View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_low_31 (Length: 323)
Name: NF17990_low_31
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 21 - 309
Target Start/End: Original strand, 5212149 - 5212437
Alignment:
| Q |
21 |
ccaagaacaatattcctagcaaaacttccaacaacaacagaagcaaaccccgaaccagccggtgtaaacaatttatcaaacacctggtctgcaacatttg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5212149 |
ccaagaacaatattcctagcaaaacttccaacaacaacagaagcaaaccccgaaccagccggtgtaaacaatttatcaaacacctggtctgcaacatttg |
5212248 |
T |
 |
| Q |
121 |
aaccagattgattttcatcaacccggttcatggattgataaccattcacaactccaagagtcacagcacgtgtcacactaaccaaagaatccgaaaactg |
220 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5212249 |
aaccggattgattttcatcaacccgattcatggattgataaccattcacaactccaacagtcacagcacgtgtcacactaaccaaagaatccgaaaactg |
5212348 |
T |
 |
| Q |
221 |
tttcgaacgcgataattttgcaatttgattcaaactattaggaacgtgatcagaatcagattgcagaaaattcttgacatcttttgtga |
309 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5212349 |
tttcgatcgcgataattttgcaatttgattcaaactattaggaacgtgatcagaatcagattgcagaaaattcttgacatcttttgtga |
5212437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University