View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_low_37 (Length: 270)
Name: NF17990_low_37
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 153 - 261
Target Start/End: Original strand, 33811935 - 33812043
Alignment:
| Q |
153 |
cccttgtaacttcctgtttcggtctctaaatttgagagtttattgacaatttgtgatggttttgtttatggtctagtatccctcctttggtgagattttc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
33811935 |
cccttgtaacttcctgtttcggtctctaaatttgagagtttattgacaatttgtgatggttttgtttatggtccagtgtccctcctttggtgagattttc |
33812034 |
T |
 |
| Q |
253 |
gtttcttct |
261 |
Q |
| |
|
||||||||| |
|
|
| T |
33812035 |
gtttcttct |
33812043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 33811800 - 33811891
Alignment:
| Q |
18 |
atttcaaacatgtcactaccgtgttctacttctagccatgcttgtgaagaaaaaccatccatgttctagtttgtgcggactgtgctacgtag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33811800 |
atttcaaacatgtcactaccgtgttctacttctagccatgcttgtgaagaaaaaccatccatgttctagtttgtgcggactgtgctacgtag |
33811891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 153 - 241
Target Start/End: Original strand, 14503246 - 14503334
Alignment:
| Q |
153 |
cccttgtaacttcctgtttcggtctctaaatttgagagtttattgacaatttgtgatggttttgtttatggtctagtatccctcctttg |
241 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||| |||||||||||| ||| | |||||||||||||||| ||||| |||| ||||| |
|
|
| T |
14503246 |
cccttgtaacttcctattttggtctccaaatttgaaagtttattgacagtttacgttggttttgtttatggtgtagtaacccttctttg |
14503334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University