View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_low_39 (Length: 258)
Name: NF17990_low_39
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 53207826 - 53208058
Alignment:
| Q |
18 |
tagataactcaaatgattcaagttaaggatttagagaccctaagtttaaatcgaaacgaatgattaaacatttgatttttaaaataccaatagtt-agaa |
116 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
53207826 |
tagataactcaacttatttaagttaaggatttagagaccctaagtttaaatcgaaacgaatgattaagcatttgatttttaaaataccaatagttaagaa |
53207925 |
T |
|
| Q |
117 |
aataataatatcaacatcaataattttggaatg-aagaagatatatatgtttc----atatgaagggaattactactttgtttgtttatagctatgtgta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53207926 |
aataataatatcaacatcaataattttggaatgaaagaagatatatatgtttcatatatatgaagggaattactactttgtttgtttatagctatgcgta |
53208025 |
T |
|
| Q |
212 |
caattgggaatcattagtgatattgtactaatt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
53208026 |
caattgggaatcattagtgatattgtactaatt |
53208058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University