View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_low_44 (Length: 245)
Name: NF17990_low_44
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 26475725 - 26475516
Alignment:
| Q |
18 |
gtagccaagttgtacttcaattgggccctttgtattttgtccctcatagtagagataaactttcccaccttcgatatgaatttagagatgctaatgaaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26475725 |
gtagccaagttgtacttcaattgggccctttgtattttgtccctcatagtagagataaactttcccaccttcgatatgaatttagagatgctcatgaaaa |
26475626 |
T |
 |
| Q |
118 |
aatgcaaatatgcgtggttttatagaagttcaggggagaaaagttgctcataatatgaatttagttgataccatgaggataattttgtttcaattttacc |
217 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26475625 |
aatgtatatatgcgtggttttatagaagttcaggggagaaaagttgctcataatatgaatttagttgataccatgaggataattttgtttcaattttacc |
26475526 |
T |
 |
| Q |
218 |
aaattcatag |
227 |
Q |
| |
|
|||| ||||| |
|
|
| T |
26475525 |
aaatccatag |
26475516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University