View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17990_low_45 (Length: 242)

Name: NF17990_low_45
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17990_low_45
NF17990_low_45
[»] chr3 (1 HSPs)
chr3 (1-193)||(55111182-55111374)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 55111374 - 55111182
Alignment:
1 aataatataatagatgtagataatttgagtgcatgtttgcattgacaatgagtttaacaaaatcacgatatagcataaactatgctatgtagcttcgata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55111374 aataatataatagatgtagataatttgagtgcatgtttgcattgacaatgagtttaacaaaatcacgatatagcataaactatgctatgtagcttcgata 55111275  T
101 aaaccacgtgtcatcgtgatttagtcaaactctatcatttcaaactaggttatgaaagactttattagccagtcttcaaacaagggctatgct 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55111274 aaaccacgtgtcatcgtgatttagtcaaactctatcatttcaaactaggttatgaaagactttattagccagtcttcaaacaagggctatgct 55111182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University