View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17990_low_47 (Length: 234)

Name: NF17990_low_47
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17990_low_47
NF17990_low_47
[»] chr2 (1 HSPs)
chr2 (13-214)||(12690094-12690295)
[»] chr5 (1 HSPs)
chr5 (175-210)||(20678556-20678591)


Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 12690295 - 12690094
Alignment:
13 gtgagatgaatttggaggtttggaaacgttttaccaatcgtggctattgagatggcatacaggagctattctcataacagttaattgtgtatgattatat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
12690295 gtgagatgaatttggaggtttggaaacgttttaccaatcgtggctattgagatggcatacaggagctattctcataacaattaattgtgtatgattatat 12690196  T
113 atttaattgaaacgatgcaaaataatagaggaacttttatcgtatatgccgatgtctcaaacatgtgaacacacttattttgaagcttttcaaacatcga 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||| ||||||||||||||||||    
12690195 atttaattgaaacgatgcaaaataatagaggaacttttatcgtatacgctgatgtctccaacatgtgaacacacttattttaaagcttttcaaacatcga 12690096  T
213 tg 214  Q
    ||    
12690095 tg 12690094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 175 - 210
Target Start/End: Original strand, 20678556 - 20678591
Alignment:
175 atgtgaacacacttattttgaagcttttcaaacatc 210  Q
    ||||||||||||||||||||||||||||||||||||    
20678556 atgtgaacacacttattttgaagcttttcaaacatc 20678591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University