View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_low_49 (Length: 227)
Name: NF17990_low_49
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 40917501 - 40917294
Alignment:
| Q |
1 |
accctaattcctcaattcctccctttcaccatttctttatttgagtagttcttaaatcatagccataggtggtaacttggggcctactaaaaataactta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40917501 |
accctaattcctcaattcctccctttcaccatttctttatttgagtagttcttaaatcatagccataggtggtaacttggggcctactaaaaataactta |
40917402 |
T |
 |
| Q |
101 |
agaacataaaacattgtttttaattaatctccttcttgcattggagatgctttttggtcactaacatattttaccgtaattctctacaatattaagaatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40917401 |
agaacataaaacattgtttttaattaatctccttcttgcattggagatgctttttggtcactaacatatttaaccgtaattctctacaatattaagaatg |
40917302 |
T |
 |
| Q |
201 |
gtgacatg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
40917301 |
gtgacatg |
40917294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 118
Target Start/End: Original strand, 14344751 - 14344795
Alignment:
| Q |
74 |
aacttggggcctactaaaaataacttaagaacataaaacattgtt |
118 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
14344751 |
aacttggggcccactaaaagtaactcaagaacataaagcattgtt |
14344795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 122
Target Start/End: Complemental strand, 50422264 - 50422216
Alignment:
| Q |
74 |
aacttggggcctactaaaaataacttaagaacataaaacattgttttta |
122 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
50422264 |
aacttggggccaattaaaaataactgaagaacatcaaacatttttttta |
50422216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University