View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17990_low_51 (Length: 220)
Name: NF17990_low_51
Description: NF17990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17990_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 127 - 202
Target Start/End: Complemental strand, 30646472 - 30646397
Alignment:
| Q |
127 |
gaatcaacggtctgttatgggtagagagttgaggtctgcgaggaccaattcgtcgcattcttcaaatatggatccc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30646472 |
gaatcaacggtctgttatgggtagagagttgaggtctgtgaggaccaattcgtcgcattcttcaaatatggatccc |
30646397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 30646583 - 30646538
Alignment:
| Q |
16 |
taggaggatttcttggtcttctagagggagtagagaaagacaaaga |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30646583 |
taggaggatttcttggtcttctagagggagtagagaaagacaaaga |
30646538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University