View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_11 (Length: 427)
Name: NF17991_high_11
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 338; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 61 - 410
Target Start/End: Original strand, 27782321 - 27782670
Alignment:
| Q |
61 |
agggaagcaaggacctttccatggaatccattgattttctagacgaaaatgagtaagtaattgacatctaagaactgtggaattcttggttcgatttttt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27782321 |
agggaagcaaggacctttccatggaatccattgattttctagacgaaaatgagtaagtaattgacatctaagaactgtggaattcttggttcgatttttt |
27782420 |
T |
|
| Q |
161 |
cttggtatatttgtgatgtaactcgttctttgcctttgaactgtggttcttgaaactctttttatgcttcgtagatacagactccttttatgcttcaatc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
27782421 |
cttggtatatttgtgatgtaactcgttctttgcctttgaactgtggttcttcaaactctttttatgcttcgtagatacggaatccttttatgcttcaatc |
27782520 |
T |
|
| Q |
261 |
agagcatgttatatttgagggatactctacaaggccatgcaatatgcttatcaaattatttatgtttgtccatgaagagtctttcagaaacatagataat |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27782521 |
agagcatgttatatttgagggatactctacaaggccatgcaatatgcttatcaaattatttatgtttgtccatgaagagtctttcagaaacatagataat |
27782620 |
T |
|
| Q |
361 |
aatacgttgataaagagtgtacatgaaataaacatcaaagccatgcaatc |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27782621 |
aatacgttgataaagagtgtacatgaaataaacatcaaagccatgcaatc |
27782670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 11 - 59
Target Start/End: Original strand, 27782239 - 27782287
Alignment:
| Q |
11 |
ttatactttacttgagaccggtttaagtttattctgtaactataaagtc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27782239 |
ttatactttacttgagaccggtttaagtttattccgtaactataaagtc |
27782287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University