View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_18 (Length: 401)
Name: NF17991_high_18
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 16481286 - 16481061
Alignment:
| Q |
1 |
gaagctccccaatcaggctcagtgaacaatagattggtaagaaaaaagttatgatcaattttcatgttcaatacttgttcattatattgcattattcctc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16481286 |
gaagctccccaatcaggctcagttaacaatagattggtaagaaaaaagttatgatcaattttcatgttcaatacttgttcattatattgcattattcctc |
16481187 |
T |
|
| Q |
101 |
atgtttgtatatgaacttcaatggaccaatatacattttatgttacctttcataccggaacatagagtattagtataatgtgtttcttaaaataaatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16481186 |
atgtttgtatatgaacttcaatggaccaatatacattttatgttacctttcataccggaacatagagtattagtataatgtgtttcttaaaataaatgtc |
16481087 |
T |
|
| Q |
201 |
acttgacacaggagtatgagcaaaat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16481086 |
acttgacacaggagtatgagcaaaat |
16481061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 303 - 384
Target Start/End: Complemental strand, 16480984 - 16480903
Alignment:
| Q |
303 |
tcaccaaggaagagcaagtacctgaggaagaaacccaaccagaggaagaggaaaaggaagttgagcttcctccactgatatc |
384 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16480984 |
tcaccgaggaagagcaagtacctgaggaagaaacccaaccagaggaagaggaaaaggaagttgagcttcctccactgatatc |
16480903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University