View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_24 (Length: 375)
Name: NF17991_high_24
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 75 - 360
Target Start/End: Complemental strand, 20059212 - 20058927
Alignment:
| Q |
75 |
aatttcaaataaatctataaataacgagtttgagtaatctcctatccaagttgtaaaagtaaatcatctattacttttgattctgcagtagctagagtta |
174 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20059212 |
aatttcaaataaatgtataaataacgagtgtgagtaatcttctatccaagttgtaaaagtaaaccatctattacttttgatgctgcagtagctagagtta |
20059113 |
T |
 |
| Q |
175 |
caaaggtgacactgctggtaacgggcacaatacacaacaactctccaacagcagcagagcgtacaattgacaatgaatctccatccatctcagccgcagc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20059112 |
caaaggtgacactgctggtaacgggcacaatacaccacaactctccaacagcagcagagcgtacaattgacaatgaatctccatccatctcagccgcagc |
20059013 |
T |
 |
| Q |
275 |
gtcggtccaatgcgtcaccattgccaaaattcatccctaacgatctcatctttggagtgttttcattgcttcctgtaaaatctgtg |
360 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20059012 |
gtcggtccaatgtgtcaccatcgccgaaattcatccctaacgatctcatctttggagtgttttcattgcttcctgtaaaatctgtg |
20058927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University