View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_27 (Length: 352)
Name: NF17991_high_27
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 13655028 - 13655356
Alignment:
| Q |
1 |
cctagaatagtctagcaccaacatagaaaatgaaagttgaattaagttagaaggatgcagcgaggaaagtacattggagaatagatggaatttaacaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13655028 |
cctagaatagtctagcaccaacatagaaaatgaaagttgaattaagttagaaggatacaacgaggaaagtacattggagaatagatggaatttaacaaca |
13655127 |
T |
 |
| Q |
101 |
ttattgcatttagcgtggaagagtagtgtgaatttcccttaattattgtcgttgctccctctatgtgtttatttctacttgtccatgttctacacaatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
13655128 |
ttattgcatttagcgtggaagagtagtgtgaatttcccttaattattgtcgttgctccctctatgtgtttatttctgcttgtccatgttctacacaatat |
13655227 |
T |
 |
| Q |
201 |
catggttcctctttttatgcagttatctttttccattttactgttccattaaacacatgaacgcaagcaaatggttctacagatcaacaatttcaacatc |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13655228 |
catggttcgtctttttatgcagttatctttttccattttactgttccattaaacacatgaacgcaagcaaatggttctacagatcaacaatttcaacatc |
13655327 |
T |
 |
| Q |
301 |
cccttcgtgtatccaattgtatccctttc |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13655328 |
cccttcgtgtatccaattgtatccctttc |
13655356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University