View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_28 (Length: 351)
Name: NF17991_high_28
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 44574826 - 44575184
Alignment:
| Q |
1 |
aagatcaaacttcagatcacttgtttaataagtctaaatttcttaacatttagaccaatctattatatgttcatcatatcttgctttnnnnnnnnnn--- |
97 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574826 |
aagatcaaacttcagatcacttatttaagaagtctaaatttcttaacatttagaccaatctattatatgttcatcatatcttgctttaaaaaataaaata |
44574925 |
T |
 |
| Q |
98 |
-----ttcgattgattaatatattatgttgataggacatcgcatgattctgacctaacctaacccgcaagtctactcagtcactcccttttgcaaccaac |
192 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574926 |
aaaaattcgattgattaatatattacgttgataggacatcgcatgattctgacctaacctaacccgcaagtctactcagtcactcccttttgcaaccaac |
44575025 |
T |
 |
| Q |
193 |
gccgtcactcttatcattcaccaatcctcgtacgtagagaaattctttcaatggctgcagcaacagatttatatttacctgatgagtgttg--------- |
283 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575026 |
gccgtcactcttatcattcaccaatcgtcgtacgtagagaaattctttcaatggctgcagcaacagatttatatttacctgatgagtgttgggaacacat |
44575125 |
T |
 |
| Q |
284 |
-------ctcttgaactgttacggctacagcgacaactactacaacagctacttgaagt |
335 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575126 |
cttcaaattcttcaactgttacggctacagcgacaactactacaacagctacttgaagt |
44575184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 283
Target Start/End: Original strand, 17626863 - 17626905
Alignment:
| Q |
241 |
caatggctgcagcaacagatttatatttacctgatgagtgttg |
283 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
17626863 |
caatggttgcagcagcagatttatatttacctaatgagtgttg |
17626905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Original strand, 6587906 - 6587947
Alignment:
| Q |
242 |
aatggctgcagcaacagatttatatttacctgatgagtgttg |
283 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
6587906 |
aatggctgcagcaacatatttatatttaccttatgattgttg |
6587947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University