View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17991_high_31 (Length: 338)

Name: NF17991_high_31
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17991_high_31
NF17991_high_31
[»] chr1 (7 HSPs)
chr1 (78-285)||(49255932-49256139)
chr1 (82-180)||(49268906-49269004)
chr1 (8-71)||(49274577-49274640)
chr1 (81-115)||(49273704-49273738)
chr1 (1-41)||(49254925-49254965)
chr1 (1-41)||(49267187-49267227)
chr1 (1-41)||(49271593-49271633)


Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 78 - 285
Target Start/End: Original strand, 49255932 - 49256139
Alignment:
78 atcatttcagctttgagtggtggtcatttgagctcctagtctttctttctggtcttcttccaaatccacagcttgaaacttctgttttatccatatggta 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49255932 atcatttcagctttgagtggtggtcatttgagctcctagtctttctttctggtcttcttccaaatccacagcttgaaacttctgttttatccatatggta 49256031  T
178 taactttccctagtgtttagttttacgcatagatgactttgcgtgtatgaaagttgtattgtaatggttacttatagtcaaatattgattccattcttat 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
49256032 taactttccctagtgtttagttttacgcatagatgactttgcgtgtatgaaagttgtattgtaatggttacttatagtcaaatactgattccattcttat 49256131  T
278 aaattagt 285  Q
    ||||||||    
49256132 aaattagt 49256139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 82 - 180
Target Start/End: Original strand, 49268906 - 49269004
Alignment:
82 tttcagctttgagtggtggtcatttgagctcctagtctttctttctggtcttcttccaaatccacagcttgaaacttctgttttatccatatggtataa 180  Q
    ||||||| ||||||||||||||||||| |||||| || |||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||    
49268906 tttcagccttgagtggtggtcatttgaactcctaatccttctttctggtcttctaccaaatccacagcttgaaacttcagtcttatccatatggtataa 49269004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 8 - 71
Target Start/End: Complemental strand, 49274640 - 49274577
Alignment:
8 ttgctatctctctttgtgctgtctctggcttcagccgttcagcgttcttgcaagtcttcttttg 71  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49274640 ttgctatctctctttgtgctgtctctggcttcagccgttcagcgttcttgcaagtcttcttttg 49274577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 81 - 115
Target Start/End: Original strand, 49273704 - 49273738
Alignment:
81 atttcagctttgagtggtggtcatttgagctccta 115  Q
    |||||||||||||||||||||||||||||||||||    
49273704 atttcagctttgagtggtggtcatttgagctccta 49273738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 49254925 - 49254965
Alignment:
1 acagctattgctatctctctttgtgctgtctctggcttcag 41  Q
    |||||||||||||||||||| |||| |||||||||||||||    
49254925 acagctattgctatctctctctgtgttgtctctggcttcag 49254965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 49267187 - 49267227
Alignment:
1 acagctattgctatctctctttgtgctgtctctggcttcag 41  Q
    |||||||||||||||||||| |||| |||||||||||||||    
49267187 acagctattgctatctctctctgtggtgtctctggcttcag 49267227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 49271593 - 49271633
Alignment:
1 acagctattgctatctctctttgtgctgtctctggcttcag 41  Q
    |||||||||||||||||||| | || |||||||||||||||    
49271593 acagctattgctatctctctctatggtgtctctggcttcag 49271633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University