View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_51 (Length: 278)
Name: NF17991_high_51
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 9574470 - 9574707
Alignment:
| Q |
19 |
ttatcaccaatatatactcaataataagagatatatcttcttttgttgggacatccagcccagtctgtgtttgtataagtgagtagttttccnnnnnnnn |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||| |||||||| |||||||||| |||||||||||| ||||||||| | |
|
|
| T |
9574470 |
ttatcaccaatatatactcaataattagagatatatcttcttgtgtcgggacatctagcccagtctatgtttgtataagcgagtagttt--cgagagagg |
9574567 |
T |
 |
| Q |
119 |
nnnnnnnnntataggttgaggctaaactcaatagtgccatgaat------aataatacttttcaaaaagacatgtgttgtgtttttgggttatgtataaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
9574568 |
agagagagatataggttgaggctaaactcaatagtgccatgaatgtaatgaataatacttttcataaagacatgtgttgtgtttttggggtatgtataaa |
9574667 |
T |
 |
| Q |
213 |
caagcacacttcttgaacttcagaagagatatttgatctt |
252 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9574668 |
caagcacacttcttgaacttcataagagatatttgatctt |
9574707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University