View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_55 (Length: 263)
Name: NF17991_high_55
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 110 - 245
Target Start/End: Original strand, 44695167 - 44695302
Alignment:
| Q |
110 |
caagtgcatctaatgcttgtgagattgcagtggttgaaggttcagttgaaggaagcaacgggagcgttgatactctgaacatgatggacactgatgttgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44695167 |
caagtgcatctaatgcttgtgagattgcagtggttgaaggttcagttgaaggaagcaacgggagcgttgatactgtgaacatgatggacactgatgttgg |
44695266 |
T |
 |
| Q |
210 |
ctgtttgatagcaactaccaattcaatgacagcagt |
245 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44695267 |
ctgtttgatggcaactaccaattcaatgacagcagt |
44695302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University