View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_57 (Length: 250)
Name: NF17991_high_57
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 33193589 - 33193369
Alignment:
| Q |
18 |
aagtaccactaattaatcacatcacaacacaacacaacattaaacattgtcgtgacatgtttttaggtatgttatccaaaagtgtaattgcatgcatatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33193589 |
aagtaccactaattaatcacatcacaacacaaca-----ttaaacatggtcgtgacatgtttttaggtatgttatccaaaagtgtaattgcatgcatatg |
33193495 |
T |
 |
| Q |
118 |
atatgacacagctactactagtactaagcttagatccattcccacactactctgtcccaagacaaacaggtagtaggttttggtttcccaagatgttctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33193494 |
atatgacacagctactactagtactaagcttagatctattcccacactactctgtcccaagacaaacaggtagtaggttttggtttcccaagatgttctt |
33193395 |
T |
 |
| Q |
218 |
ttccaacttgcgttatcttcatctca |
243 |
Q |
| |
|
||||||||||||| |||||| ||||| |
|
|
| T |
33193394 |
ttccaacttgcgtcatcttcttctca |
33193369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University