View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_high_59 (Length: 241)
Name: NF17991_high_59
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_high_59 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 228
Target Start/End: Complemental strand, 34826800 - 34826589
Alignment:
| Q |
17 |
atatacaagatacaagaaagaaaacctgccacaaaatttcagtgtgggagtgtatgagcttggtgtaggttcgtcgactagtgatttagggtgtgaaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826800 |
atatacaagatacaagaaagaaaacctgccacaaaatttcagtgtgggagtgtatgagcttggtgtaggttcgtcgactagtgatttagggtgtgaaatt |
34826701 |
T |
 |
| Q |
117 |
tacaagcttgcgactgaccctcatggcgtagtagtggtttatattggaaaatctgttgatgtgagaaaaatactccaaagttatagcaaagatggaggtc |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826700 |
tacaagcttgcgaccgaccctcatggcgtagtagtggtttatattggaaaatctgttgatgtgagaaaaatactccaaagttatagcaaagatggaggtc |
34826601 |
T |
 |
| Q |
217 |
atttgggtgatg |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34826600 |
atttgggtgatg |
34826589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University