View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_low_47 (Length: 310)
Name: NF17991_low_47
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 9e-64; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 167 - 294
Target Start/End: Original strand, 1387154 - 1387281
Alignment:
| Q |
167 |
ccttccatttgcttgttttttcacaggttttacaattggcctaaatgaattttctgataaaaccatcgaagaattttgtgattgttcaaaagtaccacct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1387154 |
ccttccatttgcttgttttttcacaggttttacaattggcctaaatgaattttctgatagaaccatcgaagaattttgtgattgttcaaaagtaccacct |
1387253 |
T |
 |
| Q |
267 |
atggatgatttcctaataactttaaaac |
294 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1387254 |
atggatgatttcctaataactttaaaac |
1387281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 11 - 102
Target Start/End: Original strand, 1386994 - 1387088
Alignment:
| Q |
11 |
gagatgaagagacgcaaagaaatattcaagatggagttggaactcatagagaagcataacagcactgcagcagg---taatattatacgcttaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1386994 |
gagatgaagagacgcaaagaaatattcaagatggagttggaactcatagagaagcataacagcactgcagcaggtaataatattatacgcttaat |
1387088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 23698273 - 23698193
Alignment:
| Q |
10 |
tgagatgaagagacgcaaagaaatattcaagatggagttggaactcatagagaagcataacagcactgcagcaggtaatat |
90 |
Q |
| |
|
||||||||| | |||||||||||||||||||| | |||||| ||||||||| ||||||||| || ||||||||||| |
|
|
| T |
23698273 |
tgagatgaaaatacgcaaagaaatattcaagaagaccttggaatccatagagaactttaacagcacagctgcaggtaatat |
23698193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University