View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17991_low_49 (Length: 303)
Name: NF17991_low_49
Description: NF17991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17991_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 10 - 284
Target Start/End: Original strand, 46531114 - 46531388
Alignment:
| Q |
10 |
gcacagaggatttcaaccgcagcactcttctactttcacaattgnnnnnnncaagaagaagaatgagttaccaccgcgaatcaatcgctaatttaaccaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46531114 |
gcacagaggatttcaaccgcagcactcttctactttcacaattgaaaaaaaccagaagaagaatgagttaccaccgcgaatcaatcgctaatttaaccaa |
46531213 |
T |
|
| Q |
110 |
gaatgctatgaacatcaccaaacatttggtatcaaaaacagaattcaagaagaagaatgtcgtgctttcaccgttgtcactccaaactgtgctcagcata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46531214 |
gaatgctatgaacatcaccaaacatttggtatcaaaaacagaattcaagaagaagaatgtcgtgctttcaccgttgtcactccaaactgtgctcagcata |
46531313 |
T |
|
| Q |
210 |
gtagctgccggttccgagggtccgacacaatgtcagcttctctccttccttggatcaaaatccattgatcatctc |
284 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46531314 |
gtagctgccggttccgagggtccgacgcaatgtcagcttctctccttccttggttcaaaatccattgatcatctc |
46531388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 183 - 274
Target Start/End: Complemental strand, 46554929 - 46554838
Alignment:
| Q |
183 |
ttgtcactccaaactgtgctcagcatagtagctgccggttccgagggtccgacacaatgtcagcttctctccttccttggatcaaaatccat |
274 |
Q |
| |
|
||||||||||||||| |||||| || || |||| |||||||||||||| || ||| ||||||||||||||||||| |||||| ||||||| |
|
|
| T |
46554929 |
ttgtcactccaaactacgctcagtatggtcactgctggttccgagggtcccactcaacgtcagcttctctccttcctcggatcagaatccat |
46554838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University