View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17992_high_10 (Length: 423)
Name: NF17992_high_10
Description: NF17992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17992_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 37145469 - 37145593
Alignment:
| Q |
1 |
atactatcgggtcgtaatgccattatattgattaatcgcttgagatatcgggggttaataggtataacaaaactcttgtctagctctggatacagaagcg |
100 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
37145469 |
atactattgggtcgtactgccattatattgattaatcgcttgagacatcgggggttaataggtataacaaaactcttgtcgtgctccggatacggaagcg |
37145568 |
T |
|
| Q |
101 |
tatgtgagcgataggtgaaagcata |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37145569 |
tatgtgagcgataggtgaaagcata |
37145593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 276 - 404
Target Start/End: Original strand, 37146327 - 37146453
Alignment:
| Q |
276 |
aaccttaaaattattacatatccactcatagaggaaagtttgaaacaaacgactaattataaggaaaatatggct-gacatatattgtgctcataataca |
374 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||| | |||||||||||| ||||||||| |
|
|
| T |
37146327 |
aaccttaaaattattacatatccattcatagaggaatgtttgaaacaaacgactaattataatgaaaatatggttcgacatatattgtactcataata-- |
37146424 |
T |
|
| Q |
375 |
gacattattatcatgcatatatggtatttg |
404 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
37146425 |
-acattattatcatgcaaatatggtatttg |
37146453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University