View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17992_high_23 (Length: 288)
Name: NF17992_high_23
Description: NF17992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17992_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 31614151 - 31613945
Alignment:
| Q |
19 |
gtgataggagaagtggtcctgttttcaattggaacagaatctggaacagaatcagcatcttcttcttctgtttgaatttctgtttcatttgtttctgtct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31614151 |
gtgataggagaagtggtcctgttttcaattggaacagaatctggaacagaatcagcatcttcttcttctgtttgaatttctgtttcatttgtttctgtct |
31614052 |
T |
 |
| Q |
119 |
caaaatctgaaacaattggtgacttgtgatgaacatacaaattttcagttgaaaaattttctactgaagaaaactcttcaatgaagctatcttgaggagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31614051 |
caaaatctgaaacaattggtgacttgtgatgaacatacaaattttcagttgaaaaattttcttctgaagaaaactcttcaatgaagctatcttgaggagt |
31613952 |
T |
 |
| Q |
219 |
gataaac |
225 |
Q |
| |
|
||||||| |
|
|
| T |
31613951 |
gataaac |
31613945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University