View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17992_high_34 (Length: 221)

Name: NF17992_high_34
Description: NF17992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17992_high_34
NF17992_high_34
[»] chr7 (1 HSPs)
chr7 (64-205)||(39835003-39835144)
[»] chr8 (1 HSPs)
chr8 (174-205)||(1779439-1779470)


Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 64 - 205
Target Start/End: Complemental strand, 39835144 - 39835003
Alignment:
64 gacagatacatggaagtacaactttgtggctgcatatgaagaactttttatggaaaaatgatggagtaccccacatctccactttgagaaatggttaaaa 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39835144 gacagatacatggaagtacaactttgtggctgcatatgaagaactttttatggaaaaatgatggagtaccccacatctccactttgagaaatggttaaaa 39835045  T
164 tttgatgggtaggagagggcagcatgtgcatgaggcttgaac 205  Q
    ||||||||||||||||||||||||||||||||||||||||||    
39835044 tttgatgggtaggagagggcagcatgtgcatgaggcttgaac 39835003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 205
Target Start/End: Complemental strand, 1779470 - 1779439
Alignment:
174 aggagagggcagcatgtgcatgaggcttgaac 205  Q
    ||||||||||||||||||||||||||||||||    
1779470 aggagagggcagcatgtgcatgaggcttgaac 1779439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University