View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17992_low_32 (Length: 254)
Name: NF17992_low_32
Description: NF17992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17992_low_32 |
 |  |
|
| [»] scaffold0113 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 22 - 249
Target Start/End: Original strand, 37145220 - 37145446
Alignment:
| Q |
22 |
ctctgttattgggattaggtatagttagctatgattatatcataaactcttaatctggctggttatatataatctctattttgttatgttcatgatttat |
121 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
37145220 |
ctctgttattgggattaagtttagttagctatgattatattgtaaacttttaatctggctggttatatataatctctatatcgttatgttcatgatttat |
37145319 |
T |
 |
| Q |
122 |
ttttgtgcttaatgcttttccgatgcaaaactccgaaattgatatttagatttagaaagtgctagacatagcctttttacttaaaaggatgtgaaataaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37145320 |
ttttgtgcttaatgcttttccgatgcaaaactccgaaattgatatttagatttagaaagcgctaaacatagcctttttactt-aaaggatgtgaaataaa |
37145418 |
T |
 |
| Q |
222 |
ttcatccatggaacttaatagctagaca |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37145419 |
ttcatccatggaacttaatagctagaca |
37145446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 88 - 140
Target Start/End: Complemental strand, 21485 - 21433
Alignment:
| Q |
88 |
atataatctctattttgttatgttcatgatttatttttgtgcttaatgctttt |
140 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
21485 |
atataatctctattttgttattttgatgatttatttttgttcttaatgctttt |
21433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University