View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17992_low_35 (Length: 221)
Name: NF17992_low_35
Description: NF17992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17992_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 64 - 205
Target Start/End: Complemental strand, 39835144 - 39835003
Alignment:
| Q |
64 |
gacagatacatggaagtacaactttgtggctgcatatgaagaactttttatggaaaaatgatggagtaccccacatctccactttgagaaatggttaaaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39835144 |
gacagatacatggaagtacaactttgtggctgcatatgaagaactttttatggaaaaatgatggagtaccccacatctccactttgagaaatggttaaaa |
39835045 |
T |
 |
| Q |
164 |
tttgatgggtaggagagggcagcatgtgcatgaggcttgaac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39835044 |
tttgatgggtaggagagggcagcatgtgcatgaggcttgaac |
39835003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 205
Target Start/End: Complemental strand, 1779470 - 1779439
Alignment:
| Q |
174 |
aggagagggcagcatgtgcatgaggcttgaac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1779470 |
aggagagggcagcatgtgcatgaggcttgaac |
1779439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University