View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17993_low_13 (Length: 265)
Name: NF17993_low_13
Description: NF17993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17993_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 53641379 - 53641190
Alignment:
| Q |
1 |
atacattatcactttaaaagcataacaagtaatgtgattcactccttaaaaagaaggtcatgtgattcatgagtttgccattcatgctaatactttaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53641379 |
atacattatcactttaaaagcataacaagtcttgtgattcactccttaaaaagaaggtcatgtgattcatgagtttgccattcatgctaatactttaaaa |
53641280 |
T |
|
| Q |
101 |
gaagtgaccgacatataaaaataatttgaaaaaattggtagcctatttgaatgttcagagttcaaatcaaaacagtggtttacattctgg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53641279 |
gaagtgaccgacatataaaaataatttgaaaaaattggtagcctatttgaatgttcagagttcaaatcaaagcagtggtttacattctgg |
53641190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University