View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17993_low_14 (Length: 253)
Name: NF17993_low_14
Description: NF17993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17993_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 55 - 235
Target Start/End: Complemental strand, 32911247 - 32911067
Alignment:
| Q |
55 |
aaagaaatacagaaatttaagtagagtgaaacctagagtttgtcatatagctttctatcactaattgggagttgcccgttcttacttacattccacgcaa |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32911247 |
aaagaaatacagaaatttaagtagagtgaaacctagagtttgtcatatagctttctatcactaattgggagttgccagttcttacttacattccacgcaa |
32911148 |
T |
 |
| Q |
155 |
tcttcaagtggcaactctctttggttgtcaattgtattttgacaattgaagtgcattgcatattattaattaccacatctt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32911147 |
tcttcaagtggcaactctctttggttgtcaattgtattttgacaattgaagtgcattgcatattattaattaccacgtctt |
32911067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University