View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17993_low_16 (Length: 237)
Name: NF17993_low_16
Description: NF17993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17993_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 29820437 - 29820266
Alignment:
| Q |
1 |
ataggtatctctctctacgcttggatggtcgagttcgtgggagtggtgttggttatccaccttggaatgctttcgttgcacaattaccgccggtaaaggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29820437 |
ataggtatctctctctacgcttggatggtcgagttcgtggaagtggtgttggttatccaccttggaatgctttcgttgcacaattaccgccggtaaaggg |
29820338 |
T |
 |
| Q |
101 |
aatctggactggcctactagatggcatggatggcagagtttagaagttcttttccatactcttgaaggatga |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29820337 |
aatctggactggcctactagatggcatggatggcagagtttagaagttcttttccatactcttgaaggatga |
29820266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 225
Target Start/End: Complemental strand, 29820255 - 29820219
Alignment:
| Q |
189 |
atatacttctcccccttatacaaggagttcagcccta |
225 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29820255 |
atatactcctcccccttatacaaggagttcagcccta |
29820219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University