View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17994_low_4 (Length: 208)
Name: NF17994_low_4
Description: NF17994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17994_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 10 - 192
Target Start/End: Complemental strand, 18963106 - 18962924
Alignment:
| Q |
10 |
gaagcaaaggtaactggattagttggttggtcattgacaatcaagcttagcacttcaggtcttgcatagtgtccaaccacatcaaaatcaaacttagctc |
109 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18963106 |
gaagcaaaagtaactggatttgttggttggtcattgacaatcaagcttagcacttcaggtcttgcatagtgtccaaccacatcaaaatcaaacttagctc |
18963007 |
T |
 |
| Q |
110 |
ttgctatttccccaatatctgtgcnnnnnnntttcaacaattagggtgtagcataattagaagctatgctttagttcaaaatt |
192 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18963006 |
ttgctatttccccaatatctgtgcaaaaaaatttcaacaattagggtgtagcataattagaagctatgctttagttcaaaatt |
18962924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 18969054 - 18968934
Alignment:
| Q |
13 |
gcaaaggtaactggattagttggttggtcattgacaatcaagcttagcacttcaggtcttgcatagtgtccaaccacatcaaaatcaaacttagctcttg |
112 |
Q |
| |
|
||||| ||||| ||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18969054 |
gcaaaagtaaccggatttgttggatggtccttgacaatcaagcttagcacttcaggtcttgcatagtgtccaaccacatcaaaatcaaacttcgctcttg |
18968955 |
T |
 |
| Q |
113 |
ctatttccccaatatctgtgc |
133 |
Q |
| |
|
||||||| |||| |||||||| |
|
|
| T |
18968954 |
ctatttcaccaagatctgtgc |
18968934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University