View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17995_high_11 (Length: 285)
Name: NF17995_high_11
Description: NF17995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17995_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 34589806 - 34589537
Alignment:
| Q |
1 |
ttattagaacattgatatttttggcgcatagaatctcatatatctttggcggtgtctcatacaatgactttttcaagaaattgaacgatcaattgcttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34589806 |
ttattagaacattgatatttttggcgcatagaatcacatatatctttggcggtgtctcatacaatgactttttcaagaa-ttgaacgatcaattgcttga |
34589708 |
T |
|
| Q |
101 |
aataagtagttcttggccttcaaatacttcaatttgatttcatctgcagctttctgttgttctgggattgttccagctggtgggattaccacccgttcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34589707 |
aataagtagttcttggccttcaaatacttcaatttgatttcatctgcagctttctgttgttctgggattgttccagctggtgggattaccacccgttcct |
34589608 |
T |
|
| Q |
201 |
ctatcagactatcacattccaatactctctggatcgatgcaggttttgcatcaacattgtctagtgattgt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34589607 |
ctatcagactatcacattccaatactctctggatcgatgcaggttttgcatcaacattgtctagtgattgt |
34589537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 136
Target Start/End: Original strand, 26281589 - 26281644
Alignment:
| Q |
79 |
aattgaacgatcaattgcttgaaataagtagttcttggccttcaaatacttcaatttg |
136 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||| |||||||||||| |||||||||| |
|
|
| T |
26281589 |
aattgatcgatcaattgcttgaaata--tagtttatggccttcaaatgcttcaatttg |
26281644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University