View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17995_high_12 (Length: 272)
Name: NF17995_high_12
Description: NF17995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17995_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 23884490 - 23884265
Alignment:
| Q |
18 |
ctgtgcttctgaaagccgattagcactatttgtacagatgcattcaaccaagattcatctttttcccgatgactccaaaaaatttatgccatttagttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23884490 |
ctgtgcttctgaaagccgattagcactatttgtacagatgcattcaaccaagattcatctttttcccgatgactccaaaaaatttatgccatctagttat |
23884391 |
T |
 |
| Q |
118 |
ctaggtatgaaaataaaccgtctttggattcaaaaatggtagcaagctgcaaattcagaactaaagcagtgattttaaatcaagccatagtactctcaac |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23884390 |
ctagctatgaaaataaaccgtctttggattcaaaaatggtagcaagctgcaaattcagaactaaagcagtgattttaaatcaagccatagtactctcaac |
23884291 |
T |
 |
| Q |
218 |
atattccattgctttcctcttcacag |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
23884290 |
atattccattgctttcctcttcacag |
23884265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University