View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17995_low_12 (Length: 303)
Name: NF17995_low_12
Description: NF17995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17995_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 289
Target Start/End: Complemental strand, 8092459 - 8092184
Alignment:
| Q |
11 |
cataggaccctttaaccatcaagtattcttttcttgaaaactttggcaaacgtttcccaactttgttaaccatcacagccggatacgtgcctgcgtataa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
8092459 |
cataggaccctttaaccatcaagtattcctttcttgaaaactttggcaaacgtttcccaactttgttaaccatcacagcaggatatgtgcctgcgtataa |
8092360 |
T |
 |
| Q |
111 |
cggttccatgaaccttgcattacacaaaattacgcgttttagaggtcttagaaacggcatcttaactgcgattgtggctgcatttgtctatatttagttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8092359 |
cggttccatgaaccttgcattacacaaaattacgcgttttagaggtcttagaaa---catcttaactgcgattgcggctgcatttgtctatatttagttt |
8092263 |
T |
 |
| Q |
211 |
gcaatgcaacttctattgcaactgcaatcgcaatttaaaagcatgatcatttctagcaacagacattttataataaaac |
289 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8092262 |
gcaatgcaacttctattgcgattgcaatcgcaatttaaaagcatgatcatttctagcaacagacattttataataaaac |
8092184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University