View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17995_low_19 (Length: 212)

Name: NF17995_low_19
Description: NF17995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17995_low_19
NF17995_low_19
[»] chr7 (2 HSPs)
chr7 (52-212)||(12211731-12211891)
chr7 (1-48)||(12211473-12211520)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 52 - 212
Target Start/End: Original strand, 12211731 - 12211891
Alignment:
Q  52 aatgatttttatttttacgttgctgtcaaaagcataatcaacaatgtatcttcacaagcctcagaattgtatatctattcatgcattgctgtaactagtg 151  Q
    |||| ||||||||||||||||||| |||||| |||||||| | |||| ||||||||||||| |||||||||||||| ||||||| ||||||||||| |||    
T  12211731 aatggtttttatttttacgttgctctcaaaaccataatcaccgatgtgtcttcacaagccttagaattgtatatcttttcatgctttgctgtaacttgtg 12211830  T
Q  152 gattattggataaattttctcatatgatttgtatatgaagtgaaatttgcttgccagatga 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  12211831 gattattggataaattttctcatatgatttgtatatgaagtgaaatttgcttgccatatga 12211891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 12211473 - 12211520
Alignment:
Q  1 taaacaagaaatacactttattttgttccacttctcttctcataggtt 48  Q
    ||||||||||| | ||||||||||||||||||||||||||||||||||    
T  12211473 taaacaagaaacatactttattttgttccacttctcttctcataggtt 12211520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University