View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17997_low_9 (Length: 291)
Name: NF17997_low_9
Description: NF17997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17997_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 20 - 274
Target Start/End: Original strand, 30506190 - 30506435
Alignment:
| Q |
20 |
tagcaatgctcaagtaatttcacattttcaaggtgctcctttcaatccttgattcaagtggtggacaagctatatagaggattaaatcgaaggatatata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
30506190 |
tagcaatgctcaagtaatttcacattttcaaggtgctccttttaacccttgattcaagtggtggacaagctata--gagga----------ggatatata |
30506277 |
T |
|
| Q |
120 |
attattaagaggccccgaattgaaaaggatacgaacaaattatatattaatactgagccagcattaca---atatatattgcaaaaataatcaaaataag |
216 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30506278 |
attattaagaggccaagaattgaaaaggttatgaacaaagtatatattaatactgaggcagcattacatatatatatattgcaaaaataatcaaaataag |
30506377 |
T |
|
| Q |
217 |
ttaataacctatatactctagttaggagggaaaatggttggcaagtaagagagatttt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30506378 |
ttaataacctatatactctagttaggagggaaaatggttggcaagtaagagagatttt |
30506435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University