View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17998_high_8 (Length: 454)
Name: NF17998_high_8
Description: NF17998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17998_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 5e-94; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 9 - 198
Target Start/End: Original strand, 45300220 - 45300407
Alignment:
| Q |
9 |
agcataggatagtggtcctagtatgggcagtggctagtggagaatgcatacataaataaccatgtggaccctctgagtctgctactatgtgtatgaatca |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45300220 |
agcatagaatagtggtcctagtatgggcagtggctagtggagaatgcatacataaataaccatgtggaccctctgagtctgctactatgt--atgaatca |
45300317 |
T |
|
| Q |
109 |
tgttattagtgtaattatagtattagttcgggaacagttgctctcaagtatagaaatgttgatgattggaattacagatttcttgacaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45300318 |
tgttattagtgtaattatagtattagttcgggaacagttgctctcaagtatagaaatgttgatgattggaattacagatttcttgacaaa |
45300407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 241 - 389
Target Start/End: Original strand, 45300407 - 45300557
Alignment:
| Q |
241 |
agtcacacccctagttccttt-ctcacaactaattaaacatctttcaagcatctagagctcaagaccctataaa-ggcattgatcacaccgttgtgattt |
338 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
45300407 |
agtcacacccctagttccttttctcacaactaattaaacatctttcaagcatctagagctcaagaccctgtaaaaggcattgatcacaccgttgtgattt |
45300506 |
T |
|
| Q |
339 |
gaaccacaacattttcgtttatggactccttaattttgagaacatctagag |
389 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45300507 |
gaaccacaacattttcttttatggactccttaattttgagaacatctagag |
45300557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 410 - 438
Target Start/End: Original strand, 45300576 - 45300604
Alignment:
| Q |
410 |
atattaagacatgttcttaggctaaaaat |
438 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45300576 |
atattaagacatgttcttaggctaaaaat |
45300604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University