View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17998_low_25 (Length: 265)
Name: NF17998_low_25
Description: NF17998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17998_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 4270783 - 4270965
Alignment:
| Q |
15 |
taatacttgcacttagtggtagtggaatagaaaataccagaaactagagagaatatggatatgtcaatgtgatcaatagaaggttactggctactataca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4270783 |
taatacttgcacttagtggtagtggaatagaaaataccagaaactagagagaatatggatatatcaatgtgatcaatagaaggttactggctactataca |
4270882 |
T |
 |
| Q |
115 |
tggatataaatatagatatagatgcggtactggcaccgagcacatgatnnnnnnnnntcactttattataacatctcacttag |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4270883 |
tggatataaatatagatatagatgcggtactggcaccgagcacatgataaaaaaaaatcactttattataacatctcacttag |
4270965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University