View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17999_high_11 (Length: 251)
Name: NF17999_high_11
Description: NF17999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17999_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 144 - 247
Target Start/End: Original strand, 47435040 - 47435146
Alignment:
| Q |
144 |
tccaaggaaacatcaac---cactgcctatatcccatcttggtgtttcttacaatatctaacgaaatagttttcacgagcaggaacaagtggtgaaggaa |
240 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47435040 |
tccaaggaaacatcaacaaccactgcccatattccatcttggtgtttcttacaatatctaacgaaatagttttcacgagcaggaacaagtggtgaaggaa |
47435139 |
T |
|
| Q |
241 |
cctgaaa |
247 |
Q |
| |
|
||||||| |
|
|
| T |
47435140 |
cctgaaa |
47435146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University