View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17999_high_19 (Length: 204)
Name: NF17999_high_19
Description: NF17999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17999_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 44381690 - 44381609
Alignment:
| Q |
13 |
tatgaagattgtcaattatcatgatctaaaacctctcaaattcaaaaacaatcaacacattgaattctattgttttctaact |
94 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
44381690 |
tatggagattgtctattatcatgatctaaaacctctcaaattcaaaaacaatcaacacactgaattatattgttttctaact |
44381609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 153 - 204
Target Start/End: Complemental strand, 44381550 - 44381499
Alignment:
| Q |
153 |
cacttaccagtttcatgctaaacagaatacatcatcagtcatcaacaaaata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44381550 |
cacttaccagtttcatgctaaacagaatacatcatcagtcatcaacaaaata |
44381499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University