View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17999_low_7 (Length: 350)
Name: NF17999_low_7
Description: NF17999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17999_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 7e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 27882011 - 27881898
Alignment:
| Q |
19 |
aaaaacttagtttacctcactctaaatacccatcgtttgccacagttgcattgcaaaagaacactaaaaaataatacaagtaaaaccttcatgattaatt |
118 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||| ||||||| |||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
27882011 |
aaaaacttagtttgcctcactctaaatgaccatcgtttgccacacttgcattacaaaaggacactaaaaaataatatgagcaaaaccttcatgattaatt |
27881912 |
T |
 |
| Q |
119 |
agaattacaactaa |
132 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
27881911 |
agaattgcaactaa |
27881898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 27881864 - 27881812
Alignment:
| Q |
136 |
agatttcccatgttcttttaccgtcatacatgtttggatttgcttaatattgg |
188 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27881864 |
agatttcccacgttcttttattgtcatacatgtttggatttgcttaatattgg |
27881812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 312
Target Start/End: Complemental strand, 27881722 - 27881689
Alignment:
| Q |
279 |
cacattttaacacctctgcaatgcaatttagcaa |
312 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
27881722 |
cacattttaacacctttgcaatgcaatttagcaa |
27881689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 32930655 - 32930581
Alignment:
| Q |
20 |
aaaacttagtttacctcactctaaatacccatcgtttgccacagttgcattgcaaaagaacactaaaaaataata |
94 |
Q |
| |
|
||||| ||||||||||||||| ||||||| | ||||||||| ||||||| |||||| ||||| ||||||||| |
|
|
| T |
32930655 |
aaaacatagtttacctcactccaaataccagccatttgccacacttgcattacaaaaggacacttcaaaataata |
32930581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University