View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1799_low_2 (Length: 314)
Name: NF1799_low_2
Description: NF1799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1799_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 6937697 - 6937398
Alignment:
| Q |
1 |
acccgcttcgttatcggtcattcaaatatggagactacgtacattatcaatattcaactagaacacaaaaggaacgacttgaaagttatgctgaaatttg |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6937697 |
accctcttcgttatcggtcattcaaatatggagactacgtacattatcaatattcaactagaacacaaaaggaacgacttgaaagttatgctgaaattta |
6937598 |
T |
 |
| Q |
101 |
atccatcattatgtgatgaaagacaatatccctttatgtaataaagtagagtaattagactctattttgcaatagattaggatcaatcaaataatatgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6937597 |
atccatcattatgtgatgaaagacaatatccctttatgtaataaagtagagtaattagactctattttgcaatagattaggatcaatcaaataatatgta |
6937498 |
T |
 |
| Q |
201 |
ttatattcatataatacaaacttatttatgttcttgcaggttaaactcttgttttttatattatataatgcggtgaaggtaggtaataacgtgtctatct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6937497 |
ttatattcatataatacaaacttatttatgttcttgcaggttaaactcttgttttttatattatataatgcggtgaaggtaggtaataacgtgcctatct |
6937398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University