View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1799_low_3 (Length: 250)
Name: NF1799_low_3
Description: NF1799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1799_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 8 - 212
Target Start/End: Original strand, 31896000 - 31896204
Alignment:
| Q |
8 |
agattattcttgcgtttcgttaaagcatgattggtaatgaaaaaatattgtcttattgaaaaacatttagacatgtcaaaattaaatttatatctctaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31896000 |
agattattcttgcgtttcgttaaagcacgattggtaatgaaaaaacattatcttattgaaaaacatttagacatgttaaaattaaatttatatctctaaa |
31896099 |
T |
|
| Q |
108 |
atgaatttcgacactttcaaaagtggaactagacatattggtgagtagaattaaaagtacatcttgaaaagttttttaaggcaatagtagtagctaggtc |
207 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31896100 |
atgaatttcgactcttccaaaagtgtaactagacatattggtgagtagaattaaaagtacatcttgaaaagttttttaaggcaatagtagtagctaggtc |
31896199 |
T |
|
| Q |
208 |
aagta |
212 |
Q |
| |
|
||||| |
|
|
| T |
31896200 |
aagta |
31896204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 211 - 250
Target Start/End: Original strand, 31896242 - 31896281
Alignment:
| Q |
211 |
tacccagattgcaatcttttgcatttattcaagtcaagta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31896242 |
tacccagattgcaatcttttgcatttattcaagtcaagta |
31896281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University