View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1799_low_5 (Length: 213)
Name: NF1799_low_5
Description: NF1799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1799_low_5 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 23 - 213
Target Start/End: Original strand, 9166226 - 9166428
Alignment:
| Q |
23 |
aggtcccctccccttggaccttcatcgtcatcatagccacnnnnnnnattcagtccatgtctgttcttcttatctacttcctcatcttcatcttcctctc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166226 |
aggtcccctccccttggaccttcatcgtcatcatagccactttttttattcagtccatgtctattcttcttatctacttcctcatcttcatcttcctctc |
9166325 |
T |
 |
| Q |
123 |
ctttatcagaggaagg------------atcatcaccagnnnnnnnacggcttctcccaccacctgcgttgctttctttgtcatctaacttccaatgttc |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166326 |
ctttatcagaggaaggaccttcatcatcatcatcaccagtttttttacggcttctcccaccacctgcgttgctttctttgtcatctaacttccaatgttc |
9166425 |
T |
 |
| Q |
211 |
acc |
213 |
Q |
| |
|
||| |
|
|
| T |
9166426 |
acc |
9166428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 81 - 213
Target Start/End: Original strand, 9154867 - 9155011
Alignment:
| Q |
81 |
gtctgttcttcttatctacttcctcatcttcatcttcctctcctttatcagaggaagg------------atcatcaccagnnnnnnnacggcttctccc |
168 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
9154867 |
gtcttttcttcctatctacttcctcgtcttcatcttcctctcctttatcagaggaaggaccttcatcttcatcatcaccagtctttttacggcctctccc |
9154966 |
T |
 |
| Q |
169 |
accacctgcgttgctttctttgtcatctaacttccaatgttcacc |
213 |
Q |
| |
|
||| ||||||||||| || |||||||||||||||| ||||||||| |
|
|
| T |
9154967 |
accccctgcgttgctctccttgtcatctaacttcccatgttcacc |
9155011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University