View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18000_high_16 (Length: 218)
Name: NF18000_high_16
Description: NF18000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18000_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 4800175 - 4800365
Alignment:
| Q |
17 |
agtaaggagagaggactaatctctaacgagaggaagaaataaagaaattaataaaacacatagttttcactttgcaattaagtaaaaggttgttgtcacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4800175 |
agtaaggagagaggactaatctctaacgagaggaagaaataaagaaattaataaaacacatagttttcactttgcaattaagtaaaaggttgttgtcacc |
4800274 |
T |
 |
| Q |
117 |
tttttctatgactgaagttgttctcacttcttcttagcatctatgctacaatcacataacca--tttattttcttagttactctgcctatg |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
4800275 |
tttttctatgactaaagttgttctcacttcttcttagcatctatgctacaatcacataaccattttttttttcttagttactctgtctatg |
4800365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University