View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18000_low_6 (Length: 271)
Name: NF18000_low_6
Description: NF18000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18000_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 38034700 - 38034950
Alignment:
| Q |
1 |
agacagttgttgaaaatggtagtgttgaaatctggtggtttgtgtaagtttttgaggtcttctaggacagttgcacataatgttgttttaggacataaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38034700 |
agacagttgttgaaaatggtagtgttgaaatctggtggtttgtgtaagtttttgaggtcttctaggacagttgcacataatgttgttttaggacataaca |
38034799 |
T |
|
| Q |
101 |
acgatgataaaattataggaacaaagatgaagcaagttgatgaaatggtggtagccatgattatgaatgtgttactatctaggatggatgatttcagaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38034800 |
acgatgataaaattataggaacaaagatgaagcaagttgatgaaatggtggtagccatgattatgaatgtgttactatctaggatggatgatttcagaac |
38034899 |
T |
|
| Q |
201 |
aacaactggtaaaggaaacgaatttagtgatgatatggaataactgtcatt |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
38034900 |
aacaactggtaaaggaaactaatttagtgatgatgtggaataactgtcatt |
38034950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University