View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18002_high_11 (Length: 382)
Name: NF18002_high_11
Description: NF18002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18002_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 65 - 372
Target Start/End: Complemental strand, 48176906 - 48176595
Alignment:
| Q |
65 |
ctctttgtatt-ggtggtaacctaactaacccactatatttccaatacatagttcttgttagaacaactctacaaaagatttacgaaataataagcgcaa |
163 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48176906 |
ctctttgtatttggtggtaacctaactaacccactatattttcaatacatagttcttgttagaacaactctacaaaagatttacgaaataataagcgcaa |
48176807 |
T |
 |
| Q |
164 |
ccaatgaacttacgatctttgttaacgaaattaatttggctaattgtgccaacgttaccgattatcaaggccatgcgcaagggtgggtctcacctccgct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48176806 |
ccaatgaacttacgatctttgttaacgaaattaatttggctaattgtgccaacgttaccgattgtcaaggccatgcgcaagggtgggtctcacctccgct |
48176707 |
T |
 |
| Q |
264 |
tgttcgtccctgcccacttgccggtacctatgaggaatatctaacatactcaacagttctacttcta---ccattctataatcagtaatagtggttccaa |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48176706 |
tgttcgtccctgcccacttgccggtacctatgaggaatatctaacatactcaacagttctacttctacttccattctataatcagtaatagtggttccaa |
48176607 |
T |
 |
| Q |
361 |
cgatgttctgtg |
372 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48176606 |
cgatgttctgtg |
48176595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University