View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18002_low_16 (Length: 270)
Name: NF18002_low_16
Description: NF18002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18002_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 256
Target Start/End: Complemental strand, 47258460 - 47258221
Alignment:
| Q |
17 |
cacacacgacactcatatgtcaacaacggtgataattttaacaaatgaattaatataatgtaattacatgtgtcagtgttatgatgatattggacaccga |
116 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47258460 |
cacacacgacactcatatgtcaacaactgtaataattttaacaaatgaattaatagaatgtaattacatgtgtcagtgttgtgatgatattggacaccga |
47258361 |
T |
|
| Q |
117 |
actctcttccggttaatgttaaagagcatgtggctaacaaattttgtgtttcaaatcaaaagcttagacatcttcaaaatgaactgacttggttaggtgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47258360 |
actctcttccggttaatgttaaagagcatgtggctaacaacttttgtgtttcaaatcaaaagcttagacatcttcaaaatgaactgacttggttaggtgt |
47258261 |
T |
|
| Q |
217 |
accctcaaatttaaccagacatcaaactgacgaaatctct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47258260 |
accctcaaatttaaccagacatcaaactgacgaaatctct |
47258221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University