View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_high_49 (Length: 294)
Name: NF18003_high_49
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_high_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 286
Target Start/End: Original strand, 46156894 - 46157163
Alignment:
| Q |
17 |
caattaacctaatccagtagcatcaatttctcaattaacctaatcgctactatcaattttgcggttaacctaaccactactatcaatttcacaattaaac |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46156894 |
caattaacctaatccagtagtatcaatttctcaattaacctaatcgctactatcaattttgcggttaacctaaccactactatcaatttcacaattaaac |
46156993 |
T |
 |
| Q |
117 |
aagtatggaagtaattaattaataaaagaaaaagaaaatcggaaagaacacgtaaagtagtgagatcaaaagaatctagacctttttctcgagtagatta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46156994 |
aagtatggaagtaattaattaataaaagaaaaagaaaatcggaaagaacacgtaaagtagtgagatcaaaagaatctagacctttttctcgagtagatta |
46157093 |
T |
 |
| Q |
217 |
gattgaactgatgcaggtatctgctgaggttgaagtccttcacgcctcttcttctgcaagctttcttctc |
286 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46157094 |
gattgaactgatgcaggcatctgctgaggttgaagtccttcacgcctcttcttctgcaagctttcttctc |
46157163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University