View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_high_64 (Length: 249)
Name: NF18003_high_64
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_high_64 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 9590159 - 9590298
Alignment:
| Q |
1 |
catgtcacctattgctgcttgcaaatcagtatggttaaaaggatgtatagtagtagattgtgattgtgcgaatccaaggagaaaaagaatcataaacaaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
9590159 |
catgtcacctattgctgcttgtaaatcagtatggttaaaaggatgtatagtagtagattgtgattgtgcaaatccaaggagaaaaagaaacataaacaaa |
9590258 |
T |
|
| Q |
101 |
tattgtagacccattttggagaaaagggaagaaaagaaat |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9590259 |
tattgtagacccattttggagaaaagggaagaaaagaaat |
9590298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University