View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18003_high_72 (Length: 213)

Name: NF18003_high_72
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18003_high_72
NF18003_high_72
[»] chr5 (1 HSPs)
chr5 (72-196)||(43224465-43224589)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 72 - 196
Target Start/End: Original strand, 43224465 - 43224589
Alignment:
72 tatcgaaaggggtttctttttatttggtacacaatgatttgggtgttttggaatgtgagaaatgataggattttcaacagtagaattgtgaccatcaatg 171  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
43224465 tatcgaaaggggtttctttttatttggcacacaatgatttgggtgttttggaatgtgagaaatgataggattttcaactgtagaattgtgaccatcaatg 43224564  T
172 agaattttggggatatcaaggttat 196  Q
    | | |||||||||||||||||||||    
43224565 aaatttttggggatatcaaggttat 43224589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University