View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18003_low_50 (Length: 308)
Name: NF18003_low_50
Description: NF18003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18003_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 29 - 293
Target Start/End: Complemental strand, 1049702 - 1049438
Alignment:
| Q |
29 |
tccaagaatatgtcaaagaaattttgtgctaattattataagaaggttgcagggtttcatccttatgatggagacattgtgtatttacattcttatgctg |
128 |
Q |
| |
|
||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1049702 |
tccaaaaaaatgtcaaagaaattttgtggtaattattataagaaggttgcagggtttcatccttatgatggagacattgtgtatttacattcttatgctg |
1049603 |
T |
|
| Q |
129 |
atggagtttttatttgcaacttaaggagtgatacatttgaagttgttcctggttatgagaaaattgatataagccattttcagttagagatagcagattt |
228 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1049602 |
atggagtttttatttgcaacttaaggactgatacatttgaagttgttcctggttatgagaaaattgatataagcccttttcagttagagatagcagattt |
1049503 |
T |
|
| Q |
229 |
gttgttgccttcagagtcatcatcaccatccacggaataaaagattattggaggagtcctggtga |
293 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| | |||||| ||||||||||||||||||| |||| |
|
|
| T |
1049502 |
gttgttgcctacagagtcatcatccccatccgctgaataagagattattggaggagtcctcgtga |
1049438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 50 - 238
Target Start/End: Complemental strand, 42875178 - 42874990
Alignment:
| Q |
50 |
ttttgtgctaattattataagaaggttgcagggtttcatccttatgatggagacattgtgtatttacattcttatgctgatggagtttttatttgcaact |
149 |
Q |
| |
|
||||||| |||||| || |||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||| ||||| ||||| ||| |
|
|
| T |
42875178 |
ttttgtgttaattactacaagagggttgcagggtttcatccttttgatggggacattgtgtatttacattcttatgctgaaggaatttttgtttgctact |
42875079 |
T |
|
| Q |
150 |
taaggagtgatacatttgaagttgttcctggttatgagaaaattgatataagccattttcagttagagatagcagatttgttgttgcct |
238 |
Q |
| |
|
|| ||| | |||||| | ||||||||||||||||||| ||||||||| | |||||| |||||||| ||||||| ||| ||||| |
|
|
| T |
42875078 |
tagggacccggaaatttgaggctgttcctggttatgagaaagctgatataagtccttttcaactagagatatcagatttattgctgcct |
42874990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 171 - 238
Target Start/End: Complemental strand, 42751405 - 42751338
Alignment:
| Q |
171 |
ttgttcctggttatgagaaaattgatataagccattttcagttagagatagcagatttgttgttgcct |
238 |
Q |
| |
|
||||||||||||||||||||| | || |||| | |||||| |||||||||||||||||| || ||||| |
|
|
| T |
42751405 |
ttgttcctggttatgagaaaactaatttaagtccttttcaattagagatagcagatttggtgctgcct |
42751338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University